Press "Enter" to skip to content

Posts tagged as “medium”

花花酱 LeetCode 187. Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

  • For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

Constraints:

  • 1 <= s.length <= 105
  • s[i] is either 'A', 'C', 'G', or 'T'.

Solution: Hashtable

Store each subsequence into the hashtable, add it into the answer array when it appears for the second time.

Time complexity: O(n*l)
Space complexity: O(n*l) -> O(n) / string_view

C++

Optimization

There are 4 type of letters, each can be encoded into 2 bits. We can represent the 10-letter-long string using 20 lowest bit of a int32. We can use int as key for the hashtable.

A -> 00
C -> 01
G -> 10
T -> 11

Time complexity: O(n)
Space complexity: O(n)

C++

花花酱 LeetCode 166. Fraction to Recurring Decimal

Given two integers representing the numerator and denominator of a fraction, return the fraction in string format.

If the fractional part is repeating, enclose the repeating part in parentheses.

If multiple answers are possible, return any of them.

It is guaranteed that the length of the answer string is less than 104 for all the given inputs.

Example 1:

Input: numerator = 1, denominator = 2
Output: "0.5"

Example 2:

Input: numerator = 2, denominator = 1
Output: "2"

Example 3:

Input: numerator = 2, denominator = 3
Output: "0.(6)"

Example 4:

Input: numerator = 4, denominator = 333
Output: "0.(012)"

Example 5:

Input: numerator = 1, denominator = 5
Output: "0.2"

Constraints:

  • -231 <= numerator, denominator <= 231 - 1
  • denominator != 0

Solution: Hashtable

Time complexity: O(?)

C++

花花酱 LeetCode 151. Reverse Words in a String

Given an input string s, reverse the order of the words.

A word is defined as a sequence of non-space characters. The words in s will be separated by at least one space.

Return a string of the words in reverse order concatenated by a single space.

Note that s may contain leading or trailing spaces or multiple spaces between two words. The returned string should only have a single space separating the words. Do not include any extra spaces.

Example 1:

Input: s = "the sky is blue"
Output: "blue is sky the"

Example 2:

Input: s = "  hello world  "
Output: "world hello"
Explanation: Your reversed string should not contain leading or trailing spaces.

Example 3:

Input: s = "a good   example"
Output: "example good a"
Explanation: You need to reduce multiple spaces between two words to a single space in the reversed string.

Example 4:

Input: s = "  Bob    Loves  Alice   "
Output: "Alice Loves Bob"

Example 5:

Input: s = "Alice does not even like bob"
Output: "bob like even not does Alice"

Constraints:

  • 1 <= s.length <= 104
  • s contains English letters (upper-case and lower-case), digits, and spaces ' '.
  • There is at least one word in s.

Follow-up: If the string data type is mutable in your language, can you solve it in-place with O(1) extra space?

Solution: Stack

Time complexity: O(n)
Space complexity: O(n)

C++

Solution: In-Place

Time complexity: O(n)
Space complexity: O(1)

C++

花花酱 LeetCode 142. Linked List Cycle II

Given the head of a linked list, return the node where the cycle begins. If there is no cycle, return null.

There is a cycle in a linked list if there is some node in the list that can be reached again by continuously following the next pointer. Internally, pos is used to denote the index of the node that tail’s next pointer is connected to (0-indexed). It is -1 if there is no cycle. Note that pos is not passed as a parameter.

Do not modify the linked list.

Example 1:

Input: head = [3,2,0,-4], pos = 1
Output: tail connects to node index 1
Explanation: There is a cycle in the linked list, where tail connects to the second node.

Example 2:

Input: head = [1,2], pos = 0
Output: tail connects to node index 0
Explanation: There is a cycle in the linked list, where tail connects to the first node.

Example 3:

Input: head = [1], pos = -1
Output: no cycle
Explanation: There is no cycle in the linked list.

Constraints:

  • The number of the nodes in the list is in the range [0, 104].
  • -105 <= Node.val <= 105
  • pos is -1 or a valid index in the linked-list.

Follow up: Can you solve it using O(1) (i.e. constant) memory?

Solution 1: Hashtset

Time complexity: O(n)
Space complexity: O(n)

C++

Solution: Fast slow pointers

Time complexity: O(n)
Space complexity: O(1)

C++

花花酱 LeetCode 2091. Removing Minimum and Maximum From Array

You are given a 0-indexed array of distinct integers nums.

There is an element in nums that has the lowest value and an element that has the highest value. We call them the minimum and maximum respectively. Your goal is to remove both these elements from the array.

A deletion is defined as either removing an element from the front of the array or removing an element from the back of the array.

Return the minimum number of deletions it would take to remove both the minimum and maximum element from the array.

Example 1:

Input: nums = [2,10,7,5,4,1,8,6]
Output: 5
Explanation: 
The minimum element in the array is nums[5], which is 1.
The maximum element in the array is nums[1], which is 10.
We can remove both the minimum and maximum by removing 2 elements from the front and 3 elements from the back.
This results in 2 + 3 = 5 deletions, which is the minimum number possible.

Example 2:

Input: nums = [0,-4,19,1,8,-2,-3,5]
Output: 3
Explanation: 
The minimum element in the array is nums[1], which is -4.
The maximum element in the array is nums[2], which is 19.
We can remove both the minimum and maximum by removing 3 elements from the front.
This results in only 3 deletions, which is the minimum number possible.

Example 3:

Input: nums = [101]
Output: 1
Explanation:  
There is only one element in the array, which makes it both the minimum and maximum element.
We can remove it with 1 deletion.

Constraints:

  • 1 <= nums.length <= 105
  • -105 <= nums[i] <= 105
  • The integers in nums are distinct.

Solution: Three ways

There are only three ways to remove min/max elements.
1) Remove front elements
2) Remove back elements
3) Remove one with front elements, and another one with back elements.

Just find the best way to do it.

Time complexity: O(n)
Space complexity: O(1)

C++