花花酱 LeetCode 187. Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

• For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

Constraints:

• 1 <= s.length <= 105
• s[i] is either 'A', 'C', 'G', or 'T'.

Solution: Hashtable

Store each subsequence into the hashtable, add it into the answer array when it appears for the second time.

Time complexity: O(n*l)
Space complexity: O(n*l) -> O(n) / string_view

Optimization

There are 4 type of letters, each can be encoded into 2 bits. We can represent the 10-letter-long string using 20 lowest bit of a int32. We can use int as key for the hashtable.

A -> 00
C -> 01
G -> 10
T -> 11

Time complexity: O(n)
Space complexity: O(n)