Press "Enter" to skip to content

Huahua's Tech Road

花花酱 LeetCode 179. Largest Number

Given a list of non-negative integers nums, arrange them such that they form the largest number.

Note: The result may be very large, so you need to return a string instead of an integer.

Example 1:

Input: nums = [10,2]
Output: "210"

Example 2:

Input: nums = [3,30,34,5,9]
Output: "9534330"

Example 3:

Input: nums = [1]
Output: "1"

Example 4:

Input: nums = [10]
Output: "10"

Constraints:

  • 1 <= nums.length <= 100
  • 0 <= nums[i] <= 109

Solution: Greedy

Sort numbers by lexical order.
e.g. 9 > 666

Time complexity: O(nlogn)
Space complexity: O(n)

C++

花花酱 LeetCode 173. Binary Search Tree Iterator

Implement the BSTIterator class that represents an iterator over the in-order traversal of a binary search tree (BST):

  • BSTIterator(TreeNode root) Initializes an object of the BSTIterator class. The root of the BST is given as part of the constructor. The pointer should be initialized to a non-existent number smaller than any element in the BST.
  • boolean hasNext() Returns true if there exists a number in the traversal to the right of the pointer, otherwise returns false.
  • int next() Moves the pointer to the right, then returns the number at the pointer.

Notice that by initializing the pointer to a non-existent smallest number, the first call to next() will return the smallest element in the BST.

You may assume that next() calls will always be valid. That is, there will be at least a next number in the in-order traversal when next() is called.

Example 1:

Input
["BSTIterator", "next", "next", "hasNext", "next", "hasNext", "next", "hasNext", "next", "hasNext"]
[[[7, 3, 15, null, null, 9, 20]], [], [], [], [], [], [], [], [], []]
Output

[null, 3, 7, true, 9, true, 15, true, 20, false]

Explanation BSTIterator bSTIterator = new BSTIterator([7, 3, 15, null, null, 9, 20]); bSTIterator.next(); // return 3 bSTIterator.next(); // return 7 bSTIterator.hasNext(); // return True bSTIterator.next(); // return 9 bSTIterator.hasNext(); // return True bSTIterator.next(); // return 15 bSTIterator.hasNext(); // return True bSTIterator.next(); // return 20 bSTIterator.hasNext(); // return False

Constraints:

  • The number of nodes in the tree is in the range [1, 105].
  • 0 <= Node.val <= 106
  • At most 105 calls will be made to hasNext, and next.

Follow up:

  • Could you implement next() and hasNext() to run in average O(1) time and use O(h) memory, where h is the height of the tree?

Solution: In-order traversal using a stack

Use a stack to simulate in-order traversal.

Each next, we walk to the left most (smallest) node and push all the nodes along the path to the stack.

Then pop the top one t as return val, our next node to explore is the right child of t.

Time complexity: amortized O(1) for next() call.
Space complexity: O(n)

C++

花花酱 LeetCode 187. Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A''C''G', and 'T'.

  • For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

Constraints:

  • 1 <= s.length <= 105
  • s[i] is either 'A''C''G', or 'T'.

Solution: Hashtable

Store each subsequence into the hashtable, add it into the answer array when it appears for the second time.

Time complexity: O(n*l)
Space complexity: O(n*l) -> O(n) / string_view

C++

Optimization

There are 4 type of letters, each can be encoded into 2 bits. We can represent the 10-letter-long string using 20 lowest bit of a int32. We can use int as key for the hashtable.

A -> 00
C -> 01
G -> 10
T -> 11

Time complexity: O(n)
Space complexity: O(n)

C++

花花酱 LeetCode 188. Best Time to Buy and Sell Stock IV

You are given an integer array prices where prices[i] is the price of a given stock on the ith day, and an integer k.

Find the maximum profit you can achieve. You may complete at most k transactions.

Note: You may not engage in multiple transactions simultaneously (i.e., you must sell the stock before you buy again).

Example 1:

Input: k = 2, prices = [2,4,1]
Output: 2
Explanation: Buy on day 1 (price = 2) and sell on day 2 (price = 4), profit = 4-2 = 2.

Example 2:

Input: k = 2, prices = [3,2,6,5,0,3]
Output: 7
Explanation: Buy on day 2 (price = 2) and sell on day 3 (price = 6), profit = 6-2 = 4. Then buy on day 5 (price = 0) and sell on day 6 (price = 3), profit = 3-0 = 3.

Constraints:

  • 0 <= k <= 100
  • 0 <= prices.length <= 1000
  • 0 <= prices[i] <= 1000

Solution: DP

profit[i][j] := max profit by making up to j sells in first i days. (Do not hold any share)
balance[i][j] := max balance by making at to up j buys in first i days. (Most hold a share)

balance[i][j] = max(balance[i-1][j], profit[i-1][j-1] – prices[i]) // do nothing or buy at i-th day.
profit[i][j] = max(profit[i-1][j], balance[i-1][j] + prices[i]) // do nothing or sell at i-th day.

ans = profit[n-1][k]

Time complexity: O(n*k)
Space complexity: O(k)

C++

Related Problems

花花酱 LeetCode 199. Binary Tree Right Side View

Given the root of a binary tree, imagine yourself standing on the right side of it, return the values of the nodes you can see ordered from top to bottom.

Example 1:

Input: root = [1,2,3,null,5,null,4]
Output: [1,3,4]

Example 2:

Input: root = [1,null,3]
Output: [1,3]

Example 3:

Input: root = []
Output: []

Constraints:

  • The number of nodes in the tree is in the range [0, 100].
  • -100 <= Node.val <= 100

Solution: Pre-order traversal

By using pre-order traversal, the right most node will be the last one to visit in each level.

Time complexity: O(n)
Space complexity: O(|height|)

C++