Press "Enter" to skip to content

Huahua's Tech Road

花花酱 LeetCode 147. Insertion Sort List

Given the head of a singly linked list, sort the list using insertion sort, and return the sorted list’s head.

The steps of the insertion sort algorithm:

  1. Insertion sort iterates, consuming one input element each repetition and growing a sorted output list.
  2. At each iteration, insertion sort removes one element from the input data, finds the location it belongs within the sorted list and inserts it there.
  3. It repeats until no input elements remain.

The following is a graphical example of the insertion sort algorithm. The partially sorted list (black) initially contains only the first element in the list. One element (red) is removed from the input data and inserted in-place into the sorted list with each iteration.

Example 1:

Input: head = [4,2,1,3]
Output: [1,2,3,4]

Example 2:

Input: head = [-1,5,3,4,0]
Output: [-1,0,3,4,5]

Constraints:

  • The number of nodes in the list is in the range [1, 5000].
  • -5000 <= Node.val <= 5000

Solution: Scan from head

For each node, scan from head of the list to find the insertion position in O(n), and adjust pointers.

Time complexity: O(n2)
Space complexity: O(1)

C++

花花酱 LeetCode 152. Maximum Product Subarray

Given an integer array nums, find a contiguous non-empty subarray within the array that has the largest product, and return the product.

It is guaranteed that the answer will fit in a 32-bit integer.

A subarray is a contiguous subsequence of the array.

Example 1:

Input: nums = [2,3,-2,4]
Output: 6
Explanation: [2,3] has the largest product 6.

Example 2:

Input: nums = [-2,0,-1]
Output: 0
Explanation: The result cannot be 2, because [-2,-1] is not a subarray.

Constraints:

  • 1 <= nums.length <= 2 * 104
  • -10 <= nums[i] <= 10
  • The product of any prefix or suffix of nums is guaranteed to fit in a 32-bit integer.

Solution: Track high and low

Compute the low / high of prefix product, reset if nums[i] is higher than high or lower than low.

Swap low and high if nums[i] is a negative number.

e.g. [2, 3, -1, 8, -2]
nums[i] = 2, low = 2, high = 2
nums[i] = 3, low = 3, high = 2 * 3 = 6
nums[i] = -1, low = 6 * -1 = -6, high = -1
nums[i] = 8, low = -6 * 8 = -48, high = 8
nums[i] = -2, low = 8*-2 = -16, high = -48 * -2 = 96

Time complexity: O(n)
Space complexity: O(1)

C++

花花酱 LeetCode 179. Largest Number

Given a list of non-negative integers nums, arrange them such that they form the largest number.

Note: The result may be very large, so you need to return a string instead of an integer.

Example 1:

Input: nums = [10,2]
Output: "210"

Example 2:

Input: nums = [3,30,34,5,9]
Output: "9534330"

Example 3:

Input: nums = [1]
Output: "1"

Example 4:

Input: nums = [10]
Output: "10"

Constraints:

  • 1 <= nums.length <= 100
  • 0 <= nums[i] <= 109

Solution: Greedy

Sort numbers by lexical order.
e.g. 9 > 666

Time complexity: O(nlogn)
Space complexity: O(n)

C++

花花酱 LeetCode 173. Binary Search Tree Iterator

Implement the BSTIterator class that represents an iterator over the in-order traversal of a binary search tree (BST):

  • BSTIterator(TreeNode root) Initializes an object of the BSTIterator class. The root of the BST is given as part of the constructor. The pointer should be initialized to a non-existent number smaller than any element in the BST.
  • boolean hasNext() Returns true if there exists a number in the traversal to the right of the pointer, otherwise returns false.
  • int next() Moves the pointer to the right, then returns the number at the pointer.

Notice that by initializing the pointer to a non-existent smallest number, the first call to next() will return the smallest element in the BST.

You may assume that next() calls will always be valid. That is, there will be at least a next number in the in-order traversal when next() is called.

Example 1:

Input
["BSTIterator", "next", "next", "hasNext", "next", "hasNext", "next", "hasNext", "next", "hasNext"]
[[[7, 3, 15, null, null, 9, 20]], [], [], [], [], [], [], [], [], []]
Output

[null, 3, 7, true, 9, true, 15, true, 20, false]

Explanation BSTIterator bSTIterator = new BSTIterator([7, 3, 15, null, null, 9, 20]); bSTIterator.next(); // return 3 bSTIterator.next(); // return 7 bSTIterator.hasNext(); // return True bSTIterator.next(); // return 9 bSTIterator.hasNext(); // return True bSTIterator.next(); // return 15 bSTIterator.hasNext(); // return True bSTIterator.next(); // return 20 bSTIterator.hasNext(); // return False

Constraints:

  • The number of nodes in the tree is in the range [1, 105].
  • 0 <= Node.val <= 106
  • At most 105 calls will be made to hasNext, and next.

Follow up:

  • Could you implement next() and hasNext() to run in average O(1) time and use O(h) memory, where h is the height of the tree?

Solution: In-order traversal using a stack

Use a stack to simulate in-order traversal.

Each next, we walk to the left most (smallest) node and push all the nodes along the path to the stack.

Then pop the top one t as return val, our next node to explore is the right child of t.

Time complexity: amortized O(1) for next() call.
Space complexity: O(n)

C++

花花酱 LeetCode 187. Repeated DNA Sequences

The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.

  • For example, "ACGAATTCCG" is a DNA sequence.

When studying DNA, it is useful to identify repeated sequences within the DNA.

Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.

Example 1:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]

Example 2:

Input: s = "AAAAAAAAAAAAA"
Output: ["AAAAAAAAAA"]

Constraints:

  • 1 <= s.length <= 105
  • s[i] is either 'A', 'C', 'G', or 'T'.

Solution: Hashtable

Store each subsequence into the hashtable, add it into the answer array when it appears for the second time.

Time complexity: O(n*l)
Space complexity: O(n*l) -> O(n) / string_view

C++

Optimization

There are 4 type of letters, each can be encoded into 2 bits. We can represent the 10-letter-long string using 20 lowest bit of a int32. We can use int as key for the hashtable.

A -> 00
C -> 01
G -> 10
T -> 11

Time complexity: O(n)
Space complexity: O(n)

C++